Biology of Blood and Marrow Transplantation
Volume 12, Issue 11 , Pages 1114-1124, November 2006

Minor Histocompatibility Antigen DDX3Y Induces HLA-DQ5-Restricted T Cell Responses with Limited TCR-Vβ Usage Both In Vivo and In Vitro

  • David Laurin

      Affiliations

    • Cell Therapy Department, Etablissement Français du Sang Région Rhône-Alpes, Rhône, France
    • David Laurin and Eric Spierings contributed equally to this study.
    • ,
  • Eric Spierings

      Affiliations

    • Department of Immunohematology and Blood Transfusion and the Laboratory of Experimental Hematology
    • David Laurin and Eric Spierings contributed equally to this study.
    • ,
  • Lars T. van der Veken

      Affiliations

    • Department of Experimental Hematology, Leiden University Medical Center, Leiden, The Netherlands
    • ,
  • Abdelbasset Hamrouni

      Affiliations

    • INSERM U524, Lille, France
    • ,
  • J.H. Frederik Falkenburg

      Affiliations

    • Department of Experimental Hematology, Leiden University Medical Center, Leiden, The Netherlands
    • ,
  • Gerard Souillet

      Affiliations

    • Department of Hematology, Hôpital Debrousse, Lyon, France
    • ,
  • Corine Vermeulen

      Affiliations

    • Department of Immunohematology and Blood Transfusion and the Laboratory of Experimental Hematology
    • ,
  • Annie Farre

      Affiliations

    • Cell Therapy Department, Etablissement Français du Sang Région Rhône-Alpes, Rhône, France
    • ,
  • Claire Galambrun

      Affiliations

    • Department of Hematology, Hôpital Debrousse, Lyon, France
    • ,
  • Dominique Rigal

      Affiliations

    • Cell Therapy Department, Etablissement Français du Sang Région Rhône-Alpes, Rhône, France
    • ,
  • Yves Bertrand

      Affiliations

    • Department of Immunology, Hôpital Lyon-Sud, Lyon, France
    • ,
  • Els Goulmy

      Affiliations

    • Department of Immunohematology and Blood Transfusion and the Laboratory of Experimental Hematology
    • ,
  • Assia Eljaafari

      Affiliations

    • Cell Therapy Department, Etablissement Français du Sang Région Rhône-Alpes, Rhône, France
    • Immunology Unit, Hospices Civils de Lyon, BioMerieux Mixed Research Immunogenomics Unit, Lyon, France
    • Corresponding Author InformationCorrespondence and reprint requests: Assia Eljaafari, MD, PhD, Hospices Civils de Lyon, bioMerieux Mixed Research Immunology Unit, Hopital E. Herriot, Place d’Arsonval, 69437 Lyon Cedex 03, France.

Received 22 January 2006; accepted 20 July 2006.

Article Outline

Abstract 

In vitro stimulation of human female T cells with male HLA-identical dendritic cells resulted in the generation of HLA-DQB1*0501/0502-restricted minor histocompatibility H-Y antigen-specific CD4+ T cell clones. Two clones generated from different HLA-identical pairs were analyzed. Use of HLA-DQ5-expressing female Epstein-Barr virus transformed B lymphoblastoid cell lines transfected with various H-Y genes and loaded with overlapping peptides demonstrated that both T cell clones are specific for a peptide encoded by DDX3Y. Previously, an HLA-DQ5-restricted T cell clone specific for the same peptide was isolated from a patient with graft-versus-host disease. Thus, we compared the T cell receptor (TCR) rearrangements of the 2 in vitro generated T cell clones and the ex vivo isolated T cell clone. All 3 clones shared the same TCRBV5-4* gene segment and 2 of 3 clones also used similar TCR-Vα segments. Our results suggest that T cells recognizing the HLA-DQ5/DDX3Y T cell epitope might be characterized by a relatively limited TCR-β repertoire. The differences in the junctional TCR-β region had no effect on the antigen specificity, but altered the capacity of the TCR to distinguish the HLA-DQ5/DDX3Y complex from its allelic counterpart. The results also demonstrate that in vitro stimulation of T cells with allogeneic HLA-identical dendritic cells may facilitate the characterization of in vivo, potentially relevant HLA class II-restricted minor H epitopes.

Key words: Minor histocompatibility antigen, Human, Graft-versus-host disease, Antigens/peptides/epitopes, T cell receptors, Dendritic cells

 

Back to Article Outline

Introduction 

Stem cell transplantation (SCT) is a curative therapy for patients with hematologic malignancies. However, in HLA-identical donor/recipient pairs, graft rejection or graft-versus-host disease (GVHD) can occur. These complications are due to vigorous T cell responses directed against minor histocompatibility (H) antigens [1, 2]. Minor H antigens are polymorphic peptides derived from endogenously processed cellular proteins and are presented on the cell surface by major histocompatibility complex (MHC) molecules [3, 4]. These proteins are encoded by multiallelic, mostly biallelic, autosomal genes that are transmitted with Mendelian segregation [5] or by the various genes on the Y chromosome [6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16]. H-Y-specific immune responses can occur because significant disparity at the amino acid residues between each H-Y gene and its X homolog can lead to peptide recognition by female T cells, whereas male T cells develop tolerance to these “self-antigens.”

In humans, a number of minor H antigens has been characterized (reviewed by Spierings et al [17]). Although a much larger number of unidentified minor H antigens may exist, it is unlikely that each individual mismatched minor H antigen is clinically relevant, because not all patients develop GVHD after HLA-matched SCT. Population studies and in vitro analyses have suggested that the HLA class I-restricted HA-1 and SMCY are more immunogenic than others [1, 18, 19]. In the case of HA-1, restricted T cell receptor (TCR) Vβ usage was suggested to be a possible molecular basis for immunodominance [20, 21].

The majority of the currently identified minor H antigens is restricted to HLA class I. However, the more frequent identification of MHC class I- rather than MHC class II-associated peptides is unlikely to be related to a more important role for CD8+ T cells in the induction of GVHD. Initiation of GVHD has been shown to require the participation of CD4+ T cells that help CD8+ cytotoxic T cells directly through cytokine secretion or indirectly through activation of dendritic cells (DCs) [13, 22, 23, 24, 25]. Importantly, CD4+ HLA class II-restricted H-Y-specific helper T cells that support the proliferation of CD8+ T cells have been isolated from a female patient who rejected a male HLA-identical stem cell transplant [13]. Moreover, involvement of CD4+ T cells is supported by mice experiments that have demonstrated rejection of syngeneic male skin grafts by T helper cells without requirement for CD8+ cytotoxic T lymphocytes [25]. In addition, the presence of CD4+ T cells with antirecipient specificity, rather than CD8+ T cells, has been shown to correlate with GVHD [22]. Further, H-Y has been shown to elicit sustained CD4+ helper T and B cell responses [6, 15, 26, 27].

We previously reported the in vitro generation of H-Y-specific, HLA-DQ5-restricted T cell clones using HLA-identical allogeneic DCs as antigen-presenting cells [28]. In the present study, using the same method, we report the generation of another CD4+ T cell clone obtained from a different HLA-identical sibling pair, which also recognizes HLA-DQ5/H-Y. Recently, an HLA class II-associated minor H-Y peptide has been identified by using T cells developed in vivo in a male patient with chronic myeloid leukemia who developed acute GVHD grade III-IV after transplantation with HLA genotypically identical female stem cells. A clone, named JBB4 (Clone Type I in Faber et al [29]), was derived by limiting dilution from this patient’s peripheral blood mononuclear cells (PBMCs) that were harvested at day 83 after transplantation during severe GVHD [30]. The peptide recognized by this clone is derived from the DDX3Y gene and its recognition is restricted by HLA-DQ5. The goal of this study was to identify HLA class II-associated minor H antigens, compare the epitopes recognized by in vitro generated T cell clones with those isolated after SCT, and analyze their TCR-β rearrangements.

Back to Article Outline

Methods 

Medium and Reagents 

RPMI-1640 medium (Life Technologies, Eggenstein, Germany) was supplemented with l-glutamine (2 mM), penicillin (100 IU/mL), streptomycin (100 μg/mL), NaHCO3 (1.5 mg/mL), and 10% pooled, heat-inactivated human AB serum. Recombinant human (rh) granulocyte-macrophage colony-stimulating factor, recombinant human interleukin (IL)-2, rhIL-4, and recombinant human tumor necrosis factor α were purchased from R&D Systems (Abington, United Kingdom). HLA typing was assessed by serology and thoroughly characterized by oligonucleotide typing. Anti-HLA class I (W632), anti-HLA-DR (L243), and anti-HLA-DP (B7-21) were kindly provided by J. Chopin (Hospital Cochin, ICGM, Paris, France), and anti-HLA-DQ (SPVL3) was purchased from Immunotech (Marseille, France).

Generation of Minor H Antigen-Specific T Cell Lines and Clones 

We stimulated 1 × 105 PBMCs from a female donor with 1 × 104 30-Gy irradiated DCs generated from her HLA-identical brother in a final volume of 200 μL in 96-well round-bottom plates. After 5 days of culture, nonadherent cells were transferred to a new culture plate. Three rounds of stimulation were carried out in 24-well plates every 10 days. In addition, 1 × 105 T cells were stimulated with 1 × 106 30-Gy irradiated HLA-identical PBMCs. Cultures were supplemented with 5 U/mL rhIL-2. Cells were subsequently tested for their specificity in proliferation and lysis assays. CD4+ T cells were further selected by depleting CD8+ T cells with anti-CD8 antibody-conjugated with magnetic beads (Dynal SA, Oslo, Norway). Graded numbers of T cells (1 × 104 to 0.6 × 103 cells/well) were then cultured in 96-well round-bottom plates with 1 × 104 irradiated PBMCs from the HLA-identical brother in the presence of 5 U/mL rhIL-2. At day 10, wells were split and tested for proliferation against 50-Gy irradiated Epstein-Barr virus transformed B (EBV-B) lymphoblastoid cell lines (LCLs) derived from the female donor, the HLA-identical brother, or HLA-mismatched individuals. Positive wells were selected and expanded by 10-day stimulations of 1 × 105 T cells with 3 × 105 HLA-identical 50-Gy irradiated EBV-B LCLs in the presence of 5 U/mL rhIL-2.

Clones were derived from these lines, as previously described [28]. Briefly, specific T cells were cloned by limiting dilution at cell concentrations of 4, 1, or 0.4 cells/well, in 96-well round-bottom microtiter plates, in the presence of 2.5 × 105/mL irradiated (30-Gy) PBMCs plus 0.5 × 105/mL irradiated (50-Gy) EBV-B LCLs derived from the allogeneic HLA-identical donor and 10 U/mL rhIL-2. The generated T cell clones were expanded in the presence of 0.5 × 105 EBV-B LCL and rhIL-2. The phenotype of the generated clones was analyzed on a FACScan using phycoerythrin/fluorescein isothiocyanate-labeled (CD4 and CD8) antibodies (BD Biosciences, Le Pont de Claix, France).

Mixed Leukocyte Reaction Assays 

T cell clones, 1 × 104 CD4+, were incubated in triplicate with 3 × 104 50-Gy irradiated EBV-B LCLs in a final volume of 200 μL in 96-well round-bottom plates. After 3 days of culture, 1 μCi/well 3H-[methyl-thymidine] was added for the last 16-18 hours. Cells were collected with a Filtermate 196 multiple harvester (Packard Inc, Prospect, Ct) and thymidine incorporation was measured in a TopCount liquid scintillation counter (Packard Inc).

DC Culture 

Monocyte-derived DCs were prepared as previously described [31, 32, 33]. Briefly, monocytes isolated from peripheral blood were cultured in plastic wells with 200 U/mL recombinant human granulocyte-macrophage colony-stimulating factor and 500 U/mL rhIL-4 for 6 days in the presence of 10% human serum. On days 2 and 5, cultures were fed by removing 3 mL medium and adding 3 mL fresh medium with cytokines. DC maturation was obtained by removing immature DCs and plating them in Teflon wells in the presence of 200 IU/mL recombinant human tumor necrosis factor α. DC differentiation and viability were checked by cytofluorimetric analyses and functional assays.

Reverse Transcriptase Polymerase Chain Reaction Amplification and Sequencing Protocols 

Total RNA from clones E6 and L14 was isolated from 1 × 106 cells using the Rnagent Kit (Promega, Madison, Wis). Total RNA was converted into first-strand cDNA using an oligo(dT) primer (Amersham Pharmacia Biotech, Orsay, France) and avian myeloblastosis virus reverse transcriptase (RT) according to the manufacturer’s specifications (Promega).

Polymerase chain reaction (PCR) amplification (30 cycles) was carried out using 25 V-region sequence-specific 5′ sense primers for TCR-Vβ families and a 3′ antisense Cβ primer as previously described [34]. As a positive internal control, 5′ sense and 3′ antisense C-region primers were included. Cycles consisted of 95°C denaturation, 57°C primer annealing, and 72°C extension steps for 1 minute each. PCR was carried out in a Biomed Thermocycler 60 (Biomed Instruments, Fullerton, Calif) using 2.5 U Taq DNA polymerase (Cetus, Emeryville, Calif) in a solution containing 4 pmol/μL of primers, 0.5 mM each of dNTP; 50 mM KCl; 10 mM Tris-HCl (pH 8.4); 4 mM MgCl; and 5 μg of sample. PCR products were sequenced by Genoscreen (Lille, France). The obtained TCR sequences were analyzed with an Internet IMGT database (http//:imgt.cines.fr:8104).

TCR sequence analysis of clone JBB4 has been described previously [35]. TCR-α PCR amplification was performed as described by Moonka and Loh [36]. Briefly, degenerated primers were designed to take advantage of a highly conserved sequence of the TCR-α variable region. The consensus primer contains an additional anchor sequence (ANB) at the 5′ end that is used during the amplification as described. The constant region primers (CA) are antisense in orientation. The CA1 primer was used for the initial PCR and the CA2 was used for a second, semi-nested PCR. Second PCR amplification products were cloned in pGEM-T Easy Vector (Promega) and sequensed using the CA2 primer. The complete sequence of the degenerated primer was CGACTCGAGTCGACATCGATC(T,A)C(T,A)C(T,A)C(T,A,G)TGGTAC(T)C(A,G)T(A,G)C(T,A,G)C(T,A)A; that of the ANB primer was CGACTCGAGTCGACATCGAT; that of the CA1 primer was CTGTGATATACACATCAGAATCC; and that of the CA2 primer was AATAGGCAGACAGACTTGTCACT. The obtained TCR sequences were analyzed using the Internet IMGT database.

Enzyme-Linked Immunosorbent Assays 

We stimulated 1.5 × 105/mL CD4+ T cell clones with 5 × 105/mL 50-Gy irradiated EBV-B LCLs in X-VIVO 20 medium (Cambrex, Emerainville, France) without serum. Supernatant was removed after 24 hours. Cytokine concentrations were evaluated by standard, commercially available enzyme-linked immunosorbent assays according to the manufacturers’ instructions (IL-4, IL-10, and interferon γ from Biosource, Nivells, Belgium; and transforming growth factor β from R&D Systems).

T Cell Epitope Characterization 

Four Y-chromosome-encoded genes (DDX3Y, EIF1AY, RPS4Y, and TMSB4Y) were retrovirally transduced into female HLA-DQ5 EBV-B LCLs as previously described [30]. H-Y-specific CD4+ T cell clones were stimulated with each of the H-Y-transduced EBV-B LCLs. Proliferation was measured by 3H-[methyl-thymidine] incorporation at day 2. For mapping of the exact MHC class II-restricted T cell epitope, we synthesized overlapping 20-mer peptides that are encoded in the regions of DDX3Y that differ from DBX and a truncated peptide from the positive 20-mer peptide. These peptides were tested with the CD4+ T cell clones at a concentration of 0.1 μg/μL, with autologous recipient EBV-B LCLs as antigen-presenting cells.

Back to Article Outline

Results 

In Vitro Generation and Specificity Analysis of Minor H Antigen-Specific CD4+ T Cell Clones 

In a previous study [28], we generated in vitro an H-Y-specific HLA-DQB1*0501/0502-restricted CD4+ T cell clone, designated as L14, from a healthy blood donor HLA-identical sibling pair whose HLA typing was HLA-A*2601/0201, -B*3901/4001, -C*1203/0304, -DRB1* 1601/0101, -DQB1*0501/0502, DPB1*0301/0401. Using the same methodology (see Methods), a second set of T cell lines was established from another HLA-identical sibling donor/recipient pair whose HLA-typing was HLA-A*0201, -B*4901/3501, -Cw*0701/0401, -DRB1*0101, DQB1* 0501, -DPB1* 0401/0402. The subsequent specificity analysis of the latter T cell lines revealed specific recognition of male but not of female stimulator cells expressing the restriction molecule HLA-DQB1*0501 or HLA-DQB1*0502. The response was significantly blocked by HLA-DQ-specific monoclonal antibodies. After limiting dilution, some T cell clones were found to be male specific and HLA-DQB1*0501/0502 restricted (Table 1). One clone, designated as E6, was selected for detailed analysis in parallel with L14, the previously isolated H-Y-specific HLA-DQB1*0501/0502-restricted CD4+ T cell clone [28]. CD4+ T cell clones E6 and L14 were stimulated with different HLA-DQ5-expressing male antigen-presenting cells (Figure 1). Both clones proliferated in response to male HLA-DQB1*0501 or HLA-DQB1*0502 antigen-presenting cells but not to HLA-DQB1*0503- or HLA-DQB1*0504-expressing male EBV-B LCLs.

Table 1. Patterns of Specificity and Restriction of Responder T Cells Issued from Sibling B
CloneF5H9E6L14
A⁎
DQ⁎0501 female sibling296±35527±108676±85329±86
DQ⁎0501 male sibling3608±708052±4219887±102422939±739
DQ⁎0501 male356±904563±43012329±386ND
DQ⁎0501 female1062±971210±35517±50ND
DQ⁎0602 male511±98448±201328±542267±341
B†
No monoclonal antibody3608±708052±42176060±909822939±739
Anti-class I3020±876412±43ND22755±3757
Anti-DR11092±2857774±33439030±196326154±915
Anti-DP2548±1946966±8357745±520624002±2908
Anti-DQ538±120928±1835903±557484±68

ND indicates not done.

⁎T cell clones from sibling B (male) were tested for their ability to proliferate against Epstein-Barr virus type B lymphoblastoid cell lines derived from sibling A (female) or from unrelated blood donors expressing/not expressing HLA-DQ0501.

†T cells from sibling B were tested in Mixed leukocyte reaction assays against Epstein-Barr virus transformed B lymphoblastoid cell lines from sibling A in the presence or absence of anti-HLA monoclonal antibodies directed against class I DR, DP, or DQ molecules. 3H-thymidine was measured at day 3. Clone L14 is shown as a positive control of specificity and restriction toward HLA-DQ0501/HY epitope.

  • View full-size image.
  • Figure 1. 

    Reactivity of H-Y minor H antigen-specific T cell clones toward HLA-DQB1*0501- and HLA-DQB1*0502- but not HLA-DQB1*0503- or HLA-DQB1*0504-expressing male EBV-B LCLs. Clones E6 (A) and L14 (B) were stimulated with various HLA-DQ5-expressing male EBV-B LCLs. Proliferation was measured by thymidine incorporation, as described in Methods.

Characterization of the HLA-DQB1*0501/0502-Restricted H-Y-Specific T Cell Epitope 

Several H-Y genes transduced into HLA-DQ5 female EBV-B LCLs were used in proliferative assays (Figure 2). Clones E6 and L14 proliferated against the DDX3Y gene-transduced EBV-B LCL but not against EBV-B LCL transduced with other H-Y genes. Autologous female EBV-B LCLs were loaded with mixtures of overlapping 20-mer DDX3Y peptides. Clones L14 and E6 proliferated against a mixture containing the divergent amino acid sequences compared with DBX 114 to 431, ie, Mix2 (Figure 3A,C). Because both clones proliferated against the same overlapping mixture of DDX3Y peptides, the individual peptides present in this mixture were further used to stimulate clones L14 and E6. Both clones recognized the peptide with the sequence TGSNCPPHIENFSDIDMGEI (Figure 3B,D). This 20-mer peptide contained the peptide recognized by HLA-DQ5-restricted H-Y-specific Cytotoxic T lymphocyte (CTL) isolated and ex vivo expanded from a patient with GVHD, whose HLA typing was HLA-A*01/02, -B*07/60(40), -Cw*03/07, -DRB1*0101/1501(2), -DRB5*01, -DQB1*0501/06, -DPB1*0401 [30]. Likewise, the 12-mer peptide reported to be the minimal peptide recognized by the ex vivo expanded clones was recognized by the clones L14 and E6 (Figure 4). Thus, the DDX3Y peptide recognized by the 2 CD4+ T cell clones generated in vitro after stimulation with DCs is identical to the DDX3Y peptide recognized by the ex vivo isolated T cell clone.

  • View full-size image.
  • Figure 2. 

    Proliferation of clones E6 and L14 in response to DBY-encoded epitopes. HLA-DQ5-expressing female EBV-B LCLs transduced with RPS4Y, TMSB4Y, EIF1AY, or DDX3Y genes were used to stimulate clone E6 (A) or clone L14 (B). HLA-identical male EBV-B LCLs were used as positive controls. Proliferation was measured by thymidine incorporation, as described in Methods.

  • View full-size image.
  • Figure 3. 

    Proliferation of clones E6 and L14 in response to particular DBY-encoded peptides. A, C, Overlapping peptides from divergent region of DDX3Y were loaded onto autologous EBV-B LCLs. Mix1 contains 11 peptides, corresponding to amino acids 1-123 of DDX3Y DBY, Mix2 contains 11 peptides from regions 114-431, and Mix3 contains 10 peptides from regions 422-630. B, D, Peptides in Mix2 were also used individually (ppt 171-190 sequence is TGSNCPPHIENFSDIDMGEI). HLA-identical male EBV-B LCLs were used as positive controls. Clone E6 (A, B) and clone L14 (C, D) proliferation was measured by thymidine incorporation, as described in Methods.

  • View full-size image.
  • Figure 4. 

    Proliferation of clones E6 and L14 in response to the previously identified minimal peptide for maximal recognition. The 20-amino acid long peptide TGSNCPPHIENFSDIDMGEI (171-190) and the 12-amino acid short peptide HIENFSDIDMGE were loaded onto autologous female EBV-B LCLs; HLA-identical male EBV-B LCLs were used as positive controls. Proliferation of clones E6 (A) and L14 (B) was measured by thymidine incorporation, as described in Methods.

TCR-β Rearrangements of the 3 HLA-DQ5-Restricted H-Y-Specific CD4+ T Cell Clones 

Although we cannot exclude the possibility that other epitopes were also targeted by other clones, the 20-mer DDX3Y epitope recognized by clones L14, E6, and JBB4 was likely to be a strong epitope. Because in many instances immunodominant peptides have been reported to select highly restricted TCR repertoires, we hypothesized that this phenomenon may be of importance for DQ5/H-Y. To address this question, we amplified the TCR rearrangements from the 3 clones by RT-PCR. For TCR-β, sequence analysis showed the usage of the same TCRBV5-4* by in vitro generated and the ex vivo expanded CD4+ T cell clones. With regard to the N-D-N regions and the TCRBJ usage, both in vitro generated clones have rearranged a TCRBD2 to a TCRBJ2-5*01 gene segment, whereas the ex vivo expanded clone has a rearranged TRBD1 to a TRBJ2-7*01 gene segment, which shares strong similarities with TCRBJ2-5*01 in the encoded amino acid sequences (Table 2). Thus, these data suggest that this particular H-Y epitope might select a relatively skewed TCR-β repertoire.

Table 2. Nucleotide and Amino Acid Sequences of TCR-β and TCR-α Junctional Regions from Clones E6 and L14 Generated after In Vitro Stimulations with Dendritic Cells and from Clone JBB4 Generated Ex Vivo at the Time of Graft-versus-Host Disease
Clone
TCR-β BV5S6A3N2T or BV5S6A3N1T or BV5S6A2T(BV5-4*..)N-D-N (BD2)BJ2S5 (BJ2-5*01)
In vitroL14TATCTCTGTGCCAGCAGCTTAGGACTGGGTCCTCAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTGCTC
Y L C A S SL G L G PQ E T Q Y F G P G T R L L V L
E6TATCTCTGTGCCAGCAGCCGAGGCCCGGGGGGCGGACAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTGCTC
Y L C A S SR G P G G GQ E T Q Y F G P G T R L L V L
BV5S6A3N2T (BV5-4*..)N-D-N (TRBD1)BJ2S7 (BJ2-7*01)
Ex vivoJBB4TATCTCTGTGCCAGCAGCGGCGGACAGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTCACA
Y L C A S SG G QY E Q Y F G P G T R L T V T
TCR-α
In vitroL14AV2 (AV12)NAJ44
TGTGCAATGTGTACCGGCACTGCCAGTAAACTCACCTTT
C A MCT G T A S K L T F
E6AV1S4 (AV8-3)NAJ56
TGTGCTGTGGGTGCAGCTGGAGCCAATAGTAAGCTGACATTTGGA
C A V GA AG A N S K L T F G
AV1S4 (AV8-3)NAJ39
Ex vivoJBB4TGTGCTGTGGGTGCGGTAGGAAATGCAGGCAACATGCTCACCTTTGGA
C A V GA VG N A G N M L T F G

TCRBD nucleotide sequences are underlined.

However, because the junctional regions of the 3 TCR-β chains were not identical, one could argue that antigen recognition rely mostly on the TCR-α chain. In that case, expression of similar TCR-α chains by the 3 clones, together with recognition requirements for the HLA-DQ5/H-Y complex, could be at the origin of the skewing of the TCR-β repertoire toward the exclusive usage of the TCRBV5-4*. As shown in Table 2, 2 of the 3 clones, ie, JBB4 and E6, have rearranged the same TCR-Vα segment (TCRAV8-3) to different TCR-Jα gene segments, whereas clone L14, which used the same combinatory TCR-β rearrangement (V-D-J) as clone E6, showed a quite distinct TCR-α rearrangement. Therefore, these results suggest that the TCR-α chain of these 3 clones, which recognize a single DDX3Y peptide in the context of HLA-DQ5, is not likely to be responsible for the common TCRBV5-4* usage.

Only the P9 Residue of HIENFSDIDMGE Is Critical for Epitope Recognition by L14 and E6 Clones 

Because the analysis of the TCR rearrangements of the 3 T cell clones demonstrated similar Vβ but different TCR-β junctional and TCR-α regions, we investigated whether the 3 disparate amino acids that differ from the DDX3X sequence (P4, P8, and P9) were equally important for DDX3Y recognition by the 3 clones. It has been reported that P4 and P9 amino acid residues are critical for DDX3Y recognition by JBB4 [30]. However, as shown in Figure 5, the proliferative responses of L14 and E6 clones were critically dependent only on residue P9. Substitution of P4 or P8 did not impair T cell proliferation of these 2 in vitro generated T cell clones, whereas, as expected, substitution of the 3 amino acid residues, P4, P8, and P9, resulted in the absence of response.

  • View full-size image.
  • Figure 5. 

    Only the P9 residue of HIENFSDIDMGE is critical for epitope recognition by L14 and E6 clones. Irradiated HLADQB1*0501 female EBV-B LCLs were primed for 1.30 hours with the indicated peptides at the concentration of 10 μg/mL or without a peptide as negative control. Then the L14 and E6 clones were added to wells at a ratio of 1:60 (clone:EBV-B LCL). After 3 days, 3H-thymidine (3HT) was added for 16 hours and proliferation was measured as indicated in Methods.

Back to Article Outline

Discussion 

Identification of minor H antigens and studies on the role of minor H antigen-specific T cell subsets in GVHD and host-versus-graft reactions are dependent on the availability of specific T cell clones. Therefore, in vitro generation of MHC class I-restricted CD8+ T cells specific for minor H antigens is feasible and relevant [37, 38]. We previously demonstrated the feasibility of generating HLA class II-restricted CD4+ T cell clones against as yet unidentified minor H antigens from healthy blood donors [28]. Here we report on comparative studies between in vitro generated and ex vivo expanded male specific MHC class II-restricted T cells in terms of their T cell epitope specificity, MHC class II restriction molecule, and TCR rearrangements. Two CD4+ T cell clones generated in vitro were derived from 2 independent HLA-identical sibling pairs. Both T cell clones exclusively recognized a male-specific minor H antigen in the context of HLA-DQB1*0501/0502. The subsequent chemical identification of the H-Y T cell epitopes recognized by the 2 in vitro generated CD4+ T cell clones revealed a single DDX3Y epitope. We previously showed in detailed analyses that the X-homolog peptide derived from the DDX3X protein could not be recognized by HLA-DQ5/HY Cytotoxic T lymphocyte [30]. This epitope was previously reported to be recognized by T cells isolated ex vivo from a patient with grade III-IV GVHD [29, 30]. Thus, although we cannot exclude the possibility that other epitopes were also the targets of other clones, the identification of a single epitope targeted by 3 clones generated from 3 different donors, using in vitro or ex vivo methodologies, suggests that HLA-DQ5/DDX3Y is likely to be a strong epitope. The strong immunogenicity of the DQ5/DDX3Y epitope is further supported by the fact that attempts to generate DRB1*1501/DDX3Y-specific T cell clones after sex-mismatched transplantation failed. Since a DRB1*1501/DDX3Y -specific T cell clone was isolated by Zorn et al [15] from a patient with chronic GVHD, detailed studies in recipient/donor pairs with different disease statuses and GVHD backgrounds and displaying 1 or both of these 2 HLA-alleles are required to further elucidate the relative immunodominance of these 2 minor H antigens. Interestingly, the profile of secretion of the 2 in vitro generated DQ5/DDX3Y-specific T cell clones was similar and showed a Th0 profile (not shown). The ex vivo isolated clone JBB4 also showed a Th0 profile, but with predominant IL-4 and interferon γ secretion [34].

Previous studies on T cell recognition of the MHC class I-restricted HA-1 antigen demonstrated the exclusive usage of TCRVB7-9*03 [21]. Also in murine studies, minor H antigen-specific CD4+ T cells displayed limited TCR-Vβ usage in 2 different mice strains [39]. These observations prompted us to analyze the TCR-Vβ usage of the 3 different MHC class II-restricted T cell clones. The same TCR-Vβ combinatory rearrangement was used by the 2 in vitro generated T cell clones, ie, TCRBV5-4*, TCRBD2, and TCRBJ2-5*01 (Table 2). The ex vivo isolated T cell clone JBB4 also used TCRBV5-4*, but with a distinct N-D-N and TCRBJ gene segment. The diversity in the N-D-N and Jβ regions and usage of an exclusive TCR-Vβ gene segment is reminiscent of a previous report showing that 12 different groups of HA-2-specific T cell clones could be identified with regard to their usage of TCR-α and -β chains in 1 patient [40]. However, in these clones, TCR-Vβ usage was restricted to only 2 different V gene segments, whereas Vα usage was diverse but always rearranged to the same Jα, thus emphasizing its role in peptide recognition. Here we report that TCRBV but neither TCRAV nor TCRAJ usage is common in 3 T cell clones generated from 3 distinct donors recognizing the same HLA class II-associated minor H peptide, suggesting that TCRBV might exert DDX3Y specificity. Accordingly, while investigating the influence of the 3 disparate amino acids that differ from the DDX3X sequence (P4, P8, and P9) on T cell recognition, we observed that only the P9 residue was critical for recognition by L14 and E6 clones, whereas P4 and P9 amino acid residues have been described as crucial residues for DDX3Y recognition by JBB4 [30]. Thus, our results demonstrate that the differences in the junctional TCRB region do not affect the antigen specificity of the DDX3Y-specific T cell clones, but rather alters the capacity of the TCR to distinguish the HLA-DQ5/DDX3Y complex from its allelic counterpart.

Thus, in accordance with a previous report that demonstrated interindividual conservation of the TCR-β chain V region by HA-1-specific T cell clones [21], our data show a limited TCRBV usage of T cells specific for an HLA class II-associated minor H-Y peptide.

HLA-DQ5 is expressed at frequencies of almost 39% in the white population and 45% in black ethnic groups. Expression of HLA-DQB1*0503 or HLA-DQB1*0504 in these populations is rare [41], whereas HLA-DQB1*0501 and HLA-DQB1*0502 are the most frequent alleles. This suggests that the HLA-DQ5/DDX3Y peptide could be frequently involved in the induction of GVHD and host-versus-graft reactions after sex-mismatched SCT.

In our study, 2 CD4+ T helper clones generated from distinct sibling pairs were produced in vitro after stimulation with HLA-identical DCs of male origin. In both cases, the responding T cells were harvested from females who had been pregnant. The risk of GVHD has been shown to be higher when male recipients receive transplants from female donors who have undergone multiple pregnancies [42, 43]. Moreover, low levels of primed H-Y-specific tetramer positive CD8+ T cells can be detected in the peripheral blood of multiparous female mice [44]. Similarly, in humans, minor H antigen-specific T cells specific for H-Y and for the autosomally encoded minor H antigens HA-1 and HA-2 can be isolated from the peripheral blood of multiparous females [45]. It is thus possible that our ability to induce T cell activation against the male antigen in vitro is due to pre-existing T cells. Analyses of the immune status with regard to DQ5/HY using ELISPOT assays have been planned.

In conclusion, we report on the recognition of the HLA-DQ5/DDX3Y epitope by 3 independently generated CD4+ T cell clones that were isolated in vitro from healthy blood donor pairs using allogeneic DCs as primary stimulators or expanded ex vivo from a patient with GVHD. These 3 clones used similar TCR-Vβs for the recognition of this epitope, which strongly suggests that HLA-DQ5/DDX3Y may be a strong epitope. Moreover, the present data demonstrate that in vitro stimulation of T cells with allogeneic HLA-identical dendritic cells may facilitate the characterization of in vivo potential relevant HLA class II-restricted minor H epitopes.

Back to Article Outline

Acknowledgments 

This work was supported by la Ligue Contre le Cancer, l’Association de Recherche contre le Cancer, l’Etablissement Français des Greffes, Leiden University Medical Center and the Netherlands Organization for Scientific Research (NWO). Eric Spierings is a Special Fellow of the Leukemia & Lymphoma Society. We thank Professor Elizabeth Simpson (Imperial College, MRC, Hammersmith Hospital, London) for helpful comments on the manuscript.

Back to Article Outline

References 

  1. Goulmy E, Schipper R, Pool J, et al. Mismatches of minor histocompatibility antigens between HLA-identical donors and recipients and the development of graft-versus-host disease after bone marrow transplantation. N Engl J Med. 1996;334:281–285
  2. Simpson E, Scott D, James E, et al. Minor H antigens: genes and peptides. Eur J Immunogenet. 2001;28:505–513
  3. Wallny HJ, Rammensee HG. Identification of classical minor histocompatibility antigen as cell-derived peptide. Nature. 1990;343:275–278
  4. Goulmy E. Human minor histocompatibility antigens: new concepts for marrow transplantation and adoptive immunotherapy. Immunol Rev. 1997;157:125–140
  5. Schreuder GM, Pool J, Blokland E, et al. A genetic analysis of human minor histocompatibility antigens demonstrates Mendelian segregation independent of HLA. Immunogenetics. 1993;38:98–105
  6. Wang W, Meadows LR, den Haan JM, et al. Human H-Y: a male-specific histocompatibility antigen derived from the SMCY protein. Science. 1995;269:1588–1590
  7. Meadows L, Wang W, den Haan JM, et al. The HLA-A*0201-restricted H-Y antigen contains a posttranslationally modified cysteine that significantly affects T cell recognition. Immunity. 1997;6:273–281
  8. Lahn BT, Page DC. Functional coherence of the human Y chromosome. Science. 1997;278:675–680
  9. Pierce RA, Field ED, den Haan JM, et al. Cutting edge: the HLA-A*0101-restricted HY minor histocompatibility antigen originates from DFFRY and contains a cysteinylated cysteine residue as identified by a novel mass spectrometric technique. J Immunol. 1999;163:6360–6364
  10. Warren EH, Gavin MA, Simpson E, et al. The human UTY gene encodes a novel HLA-B8-restricted H-Y antigen. J Immunol. 2000;164:2807–2814
  11. Vogt MH, de Paus RA, Voogt PJ, Willemze R, Falkenburg JH. DFFRY codes for a new human male-specific minor transplantation antigen involved in bone marrow graft rejection. Blood. 2000;95:1100–1105
  12. Vogt MH, Goulmy E, Kloosterboer FM, et al. UTY gene codes for an HLA-B60-restricted human male-specific minor histocompatibility antigen involved in stem cell graft rejection: characterization of the critical polymorphic amino acid residues for T-cell recognition. Blood. 2000;96:3126–3132
  13. Spierings E, Vermeulen CJ, Vogt MH, et al. Identification of HLA class II-restricted H-Y-specific T-helper epitope evoking CD4+ T-helper cells in H-Y-mismatched transplantation. Lancet. 2003;362:610–615
  14. Torikai H, Akatsuka Y, Miyazaki M, et al. A Novel HLA-A*3303-restricted minor histocompatibility antigen encoded by an unconventional open reading frame of human TMSB4Y gene. J Immunol. 2004;173:7046–7054
  15. Zorn E, Miklos DB, Floyd BH, et al. Minor histocompatibility antigen DBY elicits a coordinated B and T cell response after allogeneic stem cell transplantation. J Exp Med. 2004;199:1133–1142
  16. Ivanov R, Aarts T, Hol S, et al. Identification of a 40S ribosomal protein S4-derived H-Y epitope able to elicit a lymphoblast-specific cytotoxic T lymphocyte response. Clin Cancer Res. 2005;11:1694–1703
  17. Spierings E, Wieles B, Goulmy E. Minor histocompatibility antigens—big in tumour therapy. Trends Immunol. 2004;25:56–60
  18. Rufer N, Wolpert E, Helg C, et al. HA-1 and the SMCY-derived peptide FIDSYICQV (H-Y) are immunodominant minor histocompatibility antigens after bone marrow transplantation. Transplantation. 1998;66:910–916
  19. Kloosterboer FM, van Luxemburg-Heijs SA, van Soest RA, et al. Direct cloning of leukemia-reactive T cells from patients treated with donor lymphocyte infusion shows a relative dominance of hematopoiesis-restricted minor histocompatibility antigen HA-1 and HA-2 specific T cells. Leukemia. 2004;18:798–808
  20. Goulmy E, Pool J, van den Elsen PJ. Interindividual conservation of T-cell receptor beta chain variable regions by minor histocompatibility antigen-specific HLA-A*0201-restricted cytotoxic T-cell clones. Blood. 1995;85:2478–2481
  21. Verdijk RM, Mutis T, Wilke M, Pool J, Schrama E, Brand A, et al. Exclusive TCRVbeta chain usage of ex vivo generated minor Histocompatibility antigen HA-1 specific cytotoxic T cells: implications for monitoring of immunotherapy of leukemia by TCRBV spectratyping. Hematol J. 2002;3:271–275
  22. van Els CA, Bakker A, Zwinderman AH, Zwaan FE, van Rood JJ, Goulmy E. Effector mechanisms in graft-versus-host disease in response to minor histocompatibility antigens (II. Evidence of a possible involvement of proliferative T cells). Transplantation. 1990;50:67–71
  23. Guerder S, Matzinger P. A fail-safe mechanism for maintaining self-tolerance. J Exp Med. 1992;176:553–564
  24. Ridge JP, Di Rosa F, Matzinger P. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature. 1998;393:474–478
  25. Zelenika D, Adams E, Mellor A, Simpson E. Rejection of H-Y disparate skin grafts by monospecific CD4+ Th1 and Th2 cells: no requirement for CD8+ T cells or B cells. J Immunol. 1998;161:1868–1874
  26. Miklos DB, Kim HT, Zorn E, et al. Antibody response to DBY minor histocompatibility antigen is induced after allogeneic stem cell transplantation and in healthy female donors. Blood. 2004;103:353–359
  27. Miklos DB, Kim HT, Miller KH, et al. Antibody responses to H-Y minor histocompatibility antigens correlate with chronic graft-versus-host disease and disease remission. Blood. 2005;105:2973–2978
  28. Eljaafari A, Farre A, Duperrier K, et al. Generation of helper and cytotoxic CD4+T cell clones specific for the minor histocompatibility antigen H-Y, after in vitro priming of human T cells by HLA-identical monocyte-derived dendritic cells. Transplantation. 2001;71:1449–1455
  29. Faber LM, van Luxemburg-Heijs SA, Veenhof WF, Willemze R, Falkenburg JH. Generation of CD4+ cytotoxic T-lymphocyte clones from a patient with severe graft-versus-host disease after allogeneic bone marrow transplantation: implications for graft-versus-leukemia reactivity. Blood. 1995;86:2821–2828
  30. Vogt MH, van den Muijsenberg JW, Goulmy E, et al. The DBY gene codes for an HLA-DQ5-restricted human male-specific minor histocompatibility antigen involved in graft-versus-host disease. Blood. 2002;99:3027–3032
  31. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med. 1994;179:1109–1118
  32. Romani N, Gruner S, Brang D, et al. Proliferating dendritic cell progenitors in human blood. J Exp Med. 1994;180:83–93
  33. Duperrier K, Eljaafari A, Dezutter-Dambuyant C, et al. Distinct subsets of dendritic cells resembling dermal DCs can be generated in vitro from monocytes, in the presence of different serum supplements. J Immunol Methods. 2000;238:119–131
  34. Hishii M, Andrews D, Boyle LA, et al. In vivo accumulation of the same anti-melanoma T cell clone in two different metastatic sites. Proc Natl Acad Sci U S A. 1997;94:1378–1383
  35. van der Veken LT, Hoogeboom M, de Paus RA, Willemze R, Falkenburg JH, Heemskerk MH. HLA class II restricted T-cell receptor gene transfer generates CD4(+) T cells with helper activity as well as cytotoxic capacity. Gene Ther. 2005;12:1686–1695
  36. Moonka D, Loh EY. A consensus primer to amplify both alpha and beta chains of the human T cell receptor. J Immunol Methods. 1994;169:41–51
  37. Mutis T, Verdijk R, Schrama E, Esendam B, Brand A, Goulmy E. Feasibility of immunotherapy of relapsed leukemia with ex vivo-generated cytotoxic T lymphocytes specific for hematopoietic system-restricted minor histocompatibility antigens. Blood. 1999;93:2336–2341
  38. Verdijk RM, Mutis T, Esendam B, et al. Polyriboinosinic polyribocytidylic acid (poly(I:C)) induces stable maturation of functionally active human dendritic cells. J Immunol. 1999;163:57–61
  39. Berger MA, Korngold R. Immunodominant CD4+ T cell receptor Vbeta repertoires involved in graft-versus-host disease responses to minor histocompatibility antigens. J Immunol. 1997;159:77–85
  40. Heemskerk MH, Hoogeboom M, de Paus RA, Kester MG, et al. Redirection of antileukemic reactivity of peripheral T lymphocytes using gene transfer of minor histocompatibility antigen HA-2-specific T-cell receptor complexes expressing a conserved alpha joining region. Blood. 2003;102:3530–3540
  41. Bodmer JG, Marsh SG, Albert ED, Bodmer WF, Bontrop RE, Dupont B, et al. Nomenclature for factors of the HLA System. In: Charron  editors. Genetic Diversity of HLA, functional and medical implications (Sevres Paris EDK). Vol II:1997;p. S505–S532Proceedings of the Twelfth International Histocompatibility Workshop
  42. Flowers ME, Pepe MS, Longton G, et al. Previous donor pregnancy as a risk factor for acute graft-versus-host disease in patients with aplastic anaemia treated by allogeneic marrow transplantation. Br J Haematol. 1990;74:492–496
  43. Kollman C, Howe CW, Anasetti C, et al. Donor characteristics as risk factors in recipients after transplantation of bone marrow from unrelated donors: the effect of donor age. Blood. 2001;98:2043–2051
  44. James E, Chai JG, Dewchand H, Macchiarulo E, Dazzi F, Simpson E. Multiparity induces priming to male-specific minor histocompatibility antigen, HY, in mice and humans. Blood. 2003;102:388–393
  45. Verdijk RM, Kloosterman A, Pool J, et al. Pregnancy induces minor histocompatibility antigen-specific cytotoxic T cells: implications for stem cell transplantation and immunotherapy. Blood. 2004;103:1961–1964

PII: S1083-8791(06)00498-8

doi:10.1016/j.bbmt.2006.07.012

Biology of Blood and Marrow Transplantation
Volume 12, Issue 11 , Pages 1114-1124, November 2006

Article Tools

* Image Usage & Resolution