Biology of Blood and Marrow Transplantation
Volume 13, Issue 9 , Pages 1005-1015, September 2007

T Cell Repertoire Development in XSCID Dogs Following Nonconditioned Allogeneic Bone Marrow Transplantation

  • William Vernau

      Affiliations

    • Department of Veterinary Pathology, Microbiology and Immunology, School of Veterinary Medicine, University of California, Davis, California
    • ,
  • Brian J. Hartnett

      Affiliations

    • Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania
    • ,
  • Douglas R. Kennedy

      Affiliations

    • Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania
    • ,
  • Peter F. Moore

      Affiliations

    • Department of Veterinary Pathology, Microbiology and Immunology, School of Veterinary Medicine, University of California, Davis, California
    • ,
  • Paula S. Henthorn

      Affiliations

    • Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania
    • ,
  • Kenneth I. Weinberg

      Affiliations

    • Division of Stem Cell Transplantation, Department of Pediatrics, Stanford University, Palo Alto, California
    • ,
  • Peter J. Felsburg

      Affiliations

    • Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania
    • Corresponding Author InformationCorrespondence and reprint requests: Peter J. Felsburg, VMD, PhD, School of Veterinary Medicine, University of Pennsylvania, 3900 Delancey Street, Philadelphia, PA 19104

Received 24 April 2007; accepted 23 May 2007. published online 07 August 2007.

Article Outline

Abstract 

Dogs with X-linked severe combined immunodeficiency (XSCID) can be successfully treated by bone marrow transplants (BMT) resulting in full immunologic reconstitution and engraftment of both donor B and T cells without the need for pretransplant conditioning. In this study, we evaluated the T cell diversity in XSCID dogs 4 months to 10.5 years following BMT. At 4 months posttransplantation, when the number of CD45RA+ (naïve) T cells had peaked and plateaued, the T cells in the transplanted dogs showed the same complex, diverse repertoire as those of normal young adult dogs. A decline in T cell diversity became evident approximately 3.5 years posttransplant, but the proportion of Vβ families showing a polyclonal Gaussian spectratype still predominated up to 7.5 years posttransplant. In 2 dogs evaluated at 7.5 and 10.5 years posttransplant, >75% of the Vβ families consisted of a skewed or oligoclonal spectratype that was associated with a CD4/CD8 ratio of <0.5. The decline in the complexity of T cell diversity in the transplanted XSCID dogs is similar to that reported for XSCID patients following BMT. However, in contrast to transplanted XSCID boys who show a significant decline in their T cell diversity by 10 to 12 years following BMT, transplanted XSCID dogs maintain a polyclonal, diverse T cell repertoire through midlife.

Key Words: Dogs, X-linked severe combined immunodeficiency, Bone marrow transplants

 

Back to Article Outline

Introduction 

Severe combined immunodeficiency (SCID) is a heterogenous group of diseases characterized by the inability to mount humoral and cell-mediated immune responses and is invariably fatal within the first 2 years of life [1, 2]. X-linked severe combined immunodeficiency (XSCID) is the most common form of the disease representing approximately 50% of all human SCID [2, 3]. XSCID is caused by mutations in the common gamma (γc) subunit of the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 (reviewed in [4, 5]). Thus, the XSCID phenotype is the complex result of multiple cytokine defects. The shared usage of the γc by receptors for growth factors that are critical for normal B, natural killer (NK), and T cell development and function explains the profound immunologic abnormalities and clinical severity of the disease.

Since the first successful HLA-identical bone marrow transplant (BMT) in a boy with XSCID in 1968 [6], BMT has become the treatment of choice for all forms of SCID [3, 7, 8, 9, 10]. SCID patients receiving a histocompatible (HLA-identical) BMT have >90% long-term survival rates [3, 8, 9]. However, the majority of patients do not have a histocompatible donor. Haploidentical BMT with T cell depletion to prevent fatal graft-versus-host disease (GVHD) has become the standard therapy for SCID patients who lack a histocompatible donor [3, 7, 8, 9, 10, 11, 12, 13]. Although T cell depletion makes BMT possible for virtually all SCID patients, long-term immune reconstitution and survival is less favorable than after histocompatible BMT, ranging from 60% to 70% [8, 9]. The most common immunologic problem in human XSCID patients following BMT is poor humoral immune reconstitution. As a result, many patients need to be maintained indefinitely on prophylactic immune globulin (IVIG) therapy [7, 8, 9, 14, 15].

Two recent studies have evaluated thymic function (thymopoiesis) and T cell diversity in SCID patients for up to 18 years after BMT without any pretransplant conditioning [16, 17]. The majority were either XSCID or Jak3-deficient patients. Most had received T cell-depleted, haploidentical transplants. These studies showed that within 6 to 12 months posttransplant there is a robust regeneration of naïve (CD45RA+) peripheral T cells with a highly diverse, polyclonal T cell repertoire that develops through active thymopoiesis as measured by T cell receptor excision circle (TREC) analysis. However, between 10 and 12 years posttransplant there was little evidence of active thymopoiesis as demonstrated by extremely low levels of naïve peripheral T cells and almost undetectable TREC levels. These changes are accompanied by significant skewing of the T cell repertoire.

Our laboratory has identified and characterized an XSCID resulting from distinct γc mutations in basset hound and cardigan Welsh corgi dogs that has a clinical and immunologic phenotype virtually identical to human XSCID [18, 19, 20, 21, 22]. We have shown that XSCID dogs can be successfully transplanted with unfractionated bone marrow or highly purified bone marrow CD34+ cells from histocompatible normal donors resulting in full immunologic reconstitution and engraftment of both donor B and T cells without the need for pretransplant conditioning [23, 24, 25]. In this study, we describe the T cell diversity in XSCID dogs 4 months to 10.5 years following nonconditioned, histocompatible BMT.

Back to Article Outline

Materials and Methods 

Dogs 

The XSCID dogs used in this study were derived from a breeding colony of XSCID dogs with γc mutations consisting of either a 4-bp deletion in exon 1 (basset mutation, R dogs) or single nucleotide insertion in exon 4 (corgi mutation, X dogs) [18, 19, 26]. Affected dogs were diagnosed shortly after birth by the absence of peripheral T cells as determined by flow cytometry and confirmed by a specific PCR-based mutation detection assay for each mutation using DNA isolated from whole blood [20, 23, 26]. DLA-identical donors for transplantation were determined by PCR assay for highly polymorphic MHC class I and class II microsatellite marker polymorphisms [27].

Bone Marrow Preparation 

Bone marrow cells were collected from the donors following euthanasia by removing a segment of the femur, flushing the marrow into a sterile Petri dish containing HBSS without calcium and magnesium (Mediatech, Fisher Scientific, Philadelphia, PA), and mincing into a single cell suspension [23, 24]. The resulting suspension was filtered through a sterile 70-μm cell strainer (Becton Dickinson, Franklin Lakes, NJ), and washed twice with HBSS. Following filtration, the cells were centrifuged and resuspended in ammonium chloride lysing buffer (Sigma Chemical, St. Louis, MO) to remove red blood cells (RBCs). After a 5-minute incubation on ice, the cells were washed twice in HBSS and the final pellet resuspended in sterile saline.

Isolation of Bone Marrow CD34+ Cells 

The resulting bone marrow cell suspension was resuspended at a final concentration of 1 × 108 cells/mL in a PBS solution containing 2 mmol/L EDTA, 0.1% BSA, and anticanine CD34 antibody 1H6 [28] at 40 μg/mL. Cells were resuspended and then labeled with the secondary antimouse IgG MACS magnetic microbeads according to the manufacturer’s protocol (Miltenyi, Auburn, CA). Labeled cells were selected on varioMACS columns as recommended by the manufacturer. Aliquots of positively selected cells were analyzed by flow cytometry to determine the purity of the eluted cells.

Bone Marrow Transplantation 

XSCID dogs had BMTs with cells from DLA-identical, normal littermate donors between 1 and 2 weeks of age without any pretransplant conditioning. Untreated nucleated bone marrow cells, containing <1% mature T cells, were administered intravenously at a dose of 1.0 to 1.5 × 108 nucleated cells/kg. Dogs transplanted with CD34+ bone marrow cells, purity >95%, received doses of 5 to 35 × 106 CD34+ cells/kg. The transplanted dogs were reared in a conventional environment and maintained on prophylactic antibiotics for the first 2 to 3 months following transplantation. None of the dogs received intravenous gamma globulin because of its lack of availability for dogs.

Flow Cytometry 

Peripheral blood mononuclear cells (PBMC) were isolated from heparinized whole blood by centrifugation over a discontinuous density gradient of Hypaque-Ficoll and stained for flow cytometric analysis as previously described [21, 23]. Analysis gates were adjusted to 1% positive staining with isotype controls. For each sample, 10,000 cells were analyzed using a Becton Dickinson FACSCalibur (Becton Dickinson, San Jose, CA). The murine monoclonal antibodies (mAb) used in this study were CA17.3G9, canine CD3; CA13.1E4, canine CD4; CA9.JD3, canine CD8α; and CA4.1D3, canine CD45RA [29, 30]. FITC conjugated F(ab′)2 goat antidog IgG (heavy- and light-chain specific) was purchased from Cappel (Durham, NC). FITC- and PE-labeled secondary antibodies were purchased from Fisher Scientific.

Proliferation Assays 

The response of peripheral blood lymphocytes to in vitro mitogenic stimulation with PHA-P (5 μg/mL; Sigma,) was performed as previously described using incorporation of tritiated thymidine [21, 23]. The results are expressed as counts per minute (CPM).

Assessment of Antigen-Specific IgG Antibody Response 

Between 4 and 6 months posttransplantation dogs were immunized intramuscularly with 0.5 mL tetanus toxoid (Lederle, Pearl River, NY). Animals were reimmunized with tetanus toxoid 2 and 4 weeks after the initial immunization. IgG-specific tetanus toxoid-specific antibody was determined using an enzyme linked immunosorbent assay (ELISA) [25]. The results are expressed as percent of response of normal dogs.

TCR Vβ CDR3-Size Spectratyping 

We have recently cloned and sequenced 43 different canine TCRβ V-D-J sequences and confirmed their specificity by sequence homology analysis with known TCRβ VDJ region sequences from other species (manuscript in preparation). Twenty-three distinct TCR Vβ segments were identified that comprised 18 different families (>80% homology at the nucleotide level). The TCR Vβ families were arbitrarily assigned numbers from BV1 to BV18, beginning with families that contained the greatest number of sequences, and numbered consecutively. Unique members of the same family were designated by assigning an additional consecutive number, for example, BV3.1, BV3.2, and BV3.3.

PCR primers were selected using the DNAstar suite of sequence analysis tools. Forward primers located in the Vβ region were selected to prime at regions of dissimiliarity between closely related Vβs. When possible, PCR amplification products were sequenced to verify the appropriate specificity of the V region primer. RNA was isolated from canine peripheral blood utilizing the Qiamp RNA miniblood isolation kit (Qiagen, Valencia, CA). First-strand cDNA was produced (50 μL) using 400 U Superscript II or alternatively Superscript III reverse transcriptase (Invitrogen, San Diego; CA) and oligo(dT) primers. For PCR reactions (25 μL total volume), 1 μL of the cDNA reaction was added to wells of a 96-well PCR plate. Master mix containing Platinum Taq (1.25 U) (Invitrogen, Gaithersburg, MD), Mg++ buffer (15 mM final) and dNTPs (400 μm each final) was added to each well using a multichannel pipettor. Subsequently 1 μL of premixed Vβ specific forward (Invitrogen) and IRD700 labeled TCR reverse primers (MWG Biotech, High Point, NC) were added to the appropriate wells using a multichannel pipettor. The primers used in this study are shown in Table 1 Plates were covered with PCR plate sealers and reactions were run on a thermocycler using the program 94°C 45 seconds, 55°C 30 seconds, and 72°C 60 seconds, for a total of 35 cycles. Four microliters of acrylamide gel loading buffer (0.05% bromphenol blue, 20 mM EDTA in formamide) were added to each well, and samples were heated to 94°C for 5 minutes. Amplification products were subsequently loaded (0.8 μL) onto a 6% 25 cm acrylamide (Longranger, Cambrex, Walkersville, IN) sequencing gel and run on a Gene Reader 4200 DNA analyzer (LiCor, Lincoln, NE). Results of the sequence run were converted into histogram plots utilizing the NIH image gel peak analysis feature [31].

Table 1. Primer List
PrimerSequence (5′-3′)Size (bp)
BV1GATTTTTAGCCTTCTGTCC156
BV2CCAGGGTCCCCGGTTTCTCA224
BV3.1ACTGCCTCCGGTCGCTTCTCAC169
BV3.2ACTGCCTTCTGGTCGCTTCTCAC168
BV3.3ACTCTGCCTTGTATCTCTGTGCTA89
BV4AGGGCCCGGAGTTTCTGGT224
BV6.1CAACAATAAGGAACTCAT213
BV6.2TCTACTTTAATCAGGGACTCAATC200
BV7GCTGCTGCTCTACTACTATGAT211
BV9GGCTGCTCTACTGGTCCTATAATA214
BV10AGCCCCGAGAAAGGACACAGTTAT277
BV12CAGCGGCCTCTACTTCTTGTGGTG89
BV13ATGGGCCGAGGCTGATCTATTATT221
BV14TGCAGAAGCCACCTACGAAAGT190
BV15GCCCCGGGACGAGGAGTTGTATC188
BV16TTTGGGCTACAGCTGATCTACTAC160
BV17AGTCTACCAGCCTCTCACAG107
BV18GTCTCCGCACGATTCTCA183
BCTCTCTGCTTCCGATGGTTCAA

For comparison of the TCR Vβ repertoire between dogs, we have classified the spectratype profiles into three categories: polyclonal Gaussian, polyclonal skewed, or oligoclonal [17]. Polyclonal Gaussian profiles have at least 6 peaks that have a Gaussian distribution. Polyclonal skewed profiles have at least 6 peaks but with a shift of peak distribution off center. Last, oligoclonal profiles have 4 or less peaks with 1 predominant peak. A representative example of each of these profiles is illustrated in Figure 1.

Back to Article Outline

Results 

Bone Marrow Transplantation 

A total of 10 bone marrow transplanted XSCID dogs were evaluated for their T cell diversity at varying times posttransplant. Table 2 describes the type of transplant, whole bone marrow or purified bone marrow CD34+ cells, the dogs received and the time posttransplant at which the initial evaluation of their T cell repertoire was performed. The oldest three dogs in this table (R743, X58, and R468) were also evaluated 3 years after the initial evaluation.

Table 2. Type of and Age Post-BMT of Initial T Cell Repertoire Evaluation
DogType of BMTAge Post-BMT⁎
R1501WBM4months
R1503WBM4months
X212WBM4months
R1475CD34(5×106/kg)6months
R1263CD34(20×106/kg)1.5years
R1163WBM2years
R868CD34(35×106/kg)3.5years
R743CD34(10×106/kg)4.5years
X58WBM5.5years
R468WBM7.5years

⁎Age post-BMT at which initial TCR Vβ analysis was performed.

Immune Reconstitution 

Prior to treatment, all XSCID dogs had the typical XSCID phenotype characterized by T cell lymphopenia with <0.5% of the peripheral blood lymphocytes being CD3+ as determined by flow cytometry. Figure 2 illustrates the kinetics of immune reconstitution in the XSCID dogs transplanted dogs with either unfractionated bone marrow or purified bone marrow CD34+ cells during the first 6 months following transplantation. The absolute lymphocyte counts (Figure 2A) and proportion of peripheral T cells (Figure 2B) had normalized by 2 months posttransplantation in both groups of dogs. At 2 months posttransplantation, when the proportion of peripheral T cells were within normal range, over 90% of the peripheral T cells in both groups expressed the CD45RA+ (naive) phenotype (Figure 2C), suggesting that they developed through a thymic-dependent pathway [16, 32, 33, 34, 35, 36]. During the initial T cell regeneration in both groups of dogs the majority of the T cells express a CD4 phenotype as evidenced by the high CD4/CD8 ratio compared to age-matched controls with the CD4/CD8 ratio decreasing to normal levels by 6 months posttransplant (Figure 2D). The ability of peripheral T cells to proliferate in response to the nonspecific T cell mitogen PHA was evaluated as a measurement of T cell function. T cell function in both groups appeared normal by 2 months posttransplant (Figure 2E). All the transplanted dogs developed normal levels of IgG-specific antibody following vaccination at 6 to 8 months posttransplant Figure 2F).

  • View full-size image.
  • Figure 2. 

    Immunologic reconstitution in XSCID dogs following transplantation with whole bone marrow or CD34+ bone marrow cells. Absolute lymphocyte counts (A), proportion of peripheral T cells (B), proportion of peripheral CD45RA+ (naïve) T cells (C), CD4/CD8 ratio (D), proliferative response following stimulation with PHA (E), and IgG speficic antibody response following immunization with tetanus toxoid (F).

Table 3 illustrates the immunologic phenotype of the transplanted dogs at the time their T cell repertoire was evaluated. All dogs had normal numbers of peripheral T cells at the time of evaluation. The CD4/CD8 ratio remained normal (>1.5) through 5.5 years posttransplant, whereas dogs evaluated after 5.5 years had a CD4/CD8 ratio ranging from 0.3 to 0.4. This is in contrast to normal dogs that maintain a normal CD4/CD8 ratio averaging 1.5 up through 9 years of age that is similar to the average CD4/CD8 ratio of 1.5 in normal humans through 75 years of age [37, 38, 39, 40]. The proportion of peripheral CD45RA+ (naïve) T cells showed the typical age-related decrease from >85% through the first 2 years posttransplant to 70% at 5.5 years posttransplant; however, the proportion of peripheral CD45RA+ T cells increased at the time of inverted CD4/CD8 ratios.

Table 3. Immunologic Phenotype of the Transplanted Dogs at the Time of TCR Vβ Analysis
DogPosttransplant⁎LymphocytesCD3†CD4/CD8CD45RA+ T Cells‡
R15014months761072.63.897.1
R15034months691081.24.298.7
X2124months608077.53.696.4
R14756months523080.64.492.9
R12631.5years480081.42.188.5
R11632years284077.21.786.7
R8683.5years398079.11.580.6
R7434.5years321078.51.871.2
7.5years185094.90.491.1
X585.5years336088.61.470.2
8.5years300096.80.392.7
R4687.5years265090.20.786.8
10.5years222094.00.396.7
Normal dogs7-9yearsold2625±812⁎⁎82.1±5.31.5±0.273.4±3.1

⁎Time posttransplant at which TCR Vβ analysis was performed.

†Prroportion of CD3+ T cells in the lymphocyte gate.

‡Proportion of CD3+ T cells that are CD45RA+.

⁎⁎Mean ± SD.

TCR Vβ Diversity following Bone Marrow Transplantation 

T cell diversity was evaluated by TCR Vβ CDR3-size spectratyping, a method that measures the size heterogeneity of the TCR hypervariable CDR3 region, in 10 XSCID dogs at varying times following BMT ranging from 4 months through 10.5 years posttransplant. Normal individuals possess complex and diverse spectratypes that are characterized by a Gaussian distribution of multiple bands representing the different lengths of the respective CDR V-D-J regions. XSCID dogs were not evaluated prior to transplant because, at that time, there were <0.5% peripheral T cells. T cell diversity was also evaluated in normal dogs ranging from 2 to 7 years of age. Figure 3 illustrates the individual spectratypes for each of the bone marrow transplanted XSCID dogs at their initial evaluation and a representative 2-year-old and 7-year-old normal dog. Figure 4 illustrates the proportion of spectratypes demonstrating a polyclonal Gaussian, polyclonal skewed, or oligoclonal profile in individual normal dogs of various ages and in transplanted XSCID dogs at various time points following BMT.

  • View full-size image.
  • Figure 3. 

    TCR Vβ spectratypes of normal dogs and XSCID dogs following bone marrow transplantation. The normal dogs are designated with an N and the bone marrow transplanted dogs designated with B. The numbers following the N represent age of the dog in years and the numbers following the B represent the age in years following transplant.

  • View full-size image.
  • Figure 4. 

    TCR Vβ spectratyping in normal dogs and transplanted XSCID dogs. Each time point represents the summary results from an individual dog. Results are expressed as percentage of total Vβ families representing a polyclonal Gaussian (PG), polyclonal skewed (PS), or oligoclonal (O) phenotype. N-2, N-4, N-7 = normal dogs at 2, 4, and 7 years of age.

TCR Vβ diversity in normal dogs remains polyclonal through at least 6 years of age, with >70% of the spectratypes exhibiting a polyclonal Gaussian profile. By 4 months post-BMT, when normal numbers of CD45RA+ T cells and normal T cell function are present, the transplanted dogs show a normal, diverse T cell repertoire with >89% of the spectratypes exhibiting a polyclonal Gaussian profile. Between 2 and 3.5 years posttransplant TCR Vβ diversity showed signs of decreasing as evidenced by a decrease in the proportion of polyclonal Gaussian profiles and the appearance of oligoclonal profiles, such that at 7.5 years posttransplant 56% of the profiles were polyclonal Gaussian and 28% oligoclonal.

We had the opportunity to evaluate the TCR Vβ diversity in the three older transplanted dogs 3 years following the initial evaluation—7.5, 8.5, and 10.5 years post-BMT. Figure 5 shows the individual spectratypes of the 3 dogs at the initial evaluation and 3 years later, whereas Figure 6 illustrates the proportion of spectratypes demonstrating a polyclonal Gaussian, polyclonal skewed, or oligoclonal profile in these dogs. At the time of the second evaluation, all 3 dogs had CD4/CD8 ratios ranging from 0.3 to 0.4. Substantial changes in the TCR Vβ diversity were observed in 2 of the dogs between the initial and second evaluation. For example, the proportion of polyclonal Gaussian spectratypes decreased from 56% to 33% in dog R743 between 4.5 and 7.5 years posttransplant, whereas the proportion of polyclonal skewed spectratypes increased from 28% to 56%, and the proportion of polyclonal Gaussian spectratypes decreased from 56% to 33% in dog R468 between 7.5 and 10.5 years posttransplant and the proportion of polyclonal skewed spectratypes increased from 17% to 50%. In the third dog, X58, the decrease in the percentage of polyclonal Gaussian TCR Vβ families was smaller, between 5.5 and 8.5 years posttransplant.

  • View full-size image.
  • Figure 5. 

    TCR Vβ spectratypes of three XSCID dogs 3 years following initial evaluation. Dog R743 was evaluated at 4.5 years and 7.5 years posttransplant. Dog X58 was evaluated at 5.5 years and 8.5 years posttransplant. Dog R468 was evaluated at 7.5 years and 10.5 years posttransplant.

  • View full-size image.
  • Figure 6. 

    TCR Vβ spectratyping in 3 transplanted XSCID dogs at initial testing and 3 years later. Results are expressed as percentage of total Vβ families representing a polyclonal Gaussian (PG), polyclonal skewed (PS), or oligoclonal (O) phenotype.

Back to Article Outline

Discussion 

The kinetics of T cell reconstitution was similar in the XSCID dogs transplanted with histocompatible whole bone marrow cells or highly purified histocompatible CD34+ bone marrow cells, essentially a T cell-depleted transplant, and is similar to that observed in human T cell-depleted histocompatible and haploidentical transplants, or purified CD34+ transplants [7, 16, 34, 41]. The delay in T cell reconstitution in the XSCID dogs transplanted with histocompatible whole bone marrow cells is in contrast to the rapid T cell engraftment in human XSCID patients following transplantation of whole bone marrow cells from a histocompatible donor because of peripheral expansion of mature T cells in the graft. Although active T cell depletion was not performed in our studies, the method used to harvest the bone marrow for the whole BMTs results in a final preparation containing <1% mature T cells, compared to the 13% to 25% mature T cells reported in aspirated human adult bone marrow preparations [42, 43, 44]. Thus, our canine transplants using whole bone marrow more closely resemble human T cell-depleted transplants than human transplants using whole bone marrow, and any T cell reconstitution depends upon active thymopoiesis.

There are similarities and differences between the results of this study in transplanted XSCID dogs and boys [16, 17]. In both the XSCID dogs and human XSCID patients, normal T cell diversity was evident when the number of CD45RA+ T cells had normalized. Both showed a decrease in the complexity of their T cell repertoire with age that appears to occur more rapidly than in normal individuals. At the time transplanted XSCID dogs and boys show a predominance of skewed or oligoclonal T cell repertoires, there was a predominance of CD8+ peripheral T cells resulting in a CD4/CD8 ratio of <1.0. The predominance of skewed or oligoclonal T cell spectratypes observed in the older XSCID boys was attributed to oligoclonal expansion within the predominant CD8+ T cell population. T cell diversity within the CD4+ and CD8+ T cell populations was not evaluated in the transplanted XSCID dogs; however, it is likely that a similar phenomenon is responsible for the observed results in the transplanted XSCID dogs. Although it is well documented that oligoclonal expansion occurs in CD8+ T cells in elderly normal humans [45, 46, 47], the overall T cell diversity remains high because the CD4/CD8 ratio remains normal and the CD4+ T cell population maintains a diverse repertoire [48].

In the human XSCID patients, the expanded CD8+ T cells expressed a memory (CD45R0+) phenotype that resulted in a ratio of CD45RA+ (naïve)/CD45R0+ (memory) T cells of approximately 0.5. The transplanted XSCID dogs showed an increase in the proportion of CD45RA+ T cells to >90% at the time CD8+ T cells became predominant. Although not directly examined in this study, we have previously shown that in immune reconstituted XSCID dogs with CD4/CD8 ratios of <0.5, approximately 50% of CD4+ T cells express a CD45RA+ phenotype, whereas >80% of the CD8+ T cells express a CD45RA+ phenotype (Kennedy et al., manuscript submitted). A possible explanation for this apparent discrepancy is that a subset of memory/activated CD8+ T cells have been shown to express a CD8+CD45RA+ phenotype [49, 50]. Hamann et al. [49] have shown these cells are induced by antigens and evolve through extensive rounds of division that results in oligoclonality of their TCR Vβ repertoire. Thus, it is likely that the CD8+CD45RA+ T cells in the transplanted XSCID dogs may represent memory CD8+ T cells.

Although the transplanted XSCID dogs showed an age-related decline in their T cell diversity similar to that observed in the transplanted human XSCID patients, this decrease appeared to be delayed in the dog. Significant skewing of the T cell repertoire occurred between 10 and 12 years posttransplant in the human XSCID patients, with the majority of Vβ families exhibiting a skewed phenotype. Predominance of skewed Vβ phenotypes was not observed in the transplanted XSCID dogs until approximately 7.5 years following transplantation, the equivalent to a 45-year-old human based upon the comparison of biologic aging between dogs and humans [51].

The transplants described in this study are similar to those performed in human XSCID patients transplanted in the neonatal period (<28 days of age) [52]. Human XSCID patients transplanted in the neonatal period show an increased success rate, more rapid increase in the regeneration of the proportion of naïve peripheral T cells and higher numbers of naïve peripheral T cells, and more rapid increase and higher numbers of TRECs following transplantation than those XSCID patients transplanted past the neonatal period. One could propose that the delay in the decline of T cell diversity observed in the XSCID dogs might be related to the fact that they were transplanted as neonates. Although the T cell repertoire was not examined in the human neonatal XSCID transplant study, transplantation in the neonatal period did not improve the long-term T cell reconstitution because at 10 years posttransplant the patients transplanted in the neonatal period showed the same decline in the number of CD45RA+ T cells and TREC levels as that seen in patients transplanted after the neonatal period. Because T cell diversity has been shown to be directly correlated with TREC levels in XSCID patients following BMT [17], it is likely that skewing of the T cell repertoire occurs at a similar time in neonatally transplanted patients as those transplanted after the neonatal period.

An alternative, and more likely, explanation is the dose of hematopoietic stem cells (HSC) used in the dog transplants. Although the dose of whole bone marrow used in this study was comparable to that used in human histocompatible transplants, the actual dose of HSC, as determined by the number of CD34+ cells, was significantly greater because of the age of the donor used in the dog studies. CD34 is expressed on a subpopulation of hematopoietic cells that contain both stem cells, presumably pluripotent stem cells, and early committed progenitors that are capable of multilineage engraftment in humans, mice, nonhuman primates, and, more recently, dogs [25, 28, 53, 54, 55, 56, 57, 58]. It is clear from a large body of clinical and experimental data that a population of cells within the CD34+ population are both pluripotent and capable of self-renewal. Although CD34 expression is currently used as a surrogate marker for human and canine HSC, it has been proposed that the T cell reconstitution observed in nonconditioned or nonmyeloablated human XSCID and Jak3 SCID patients results from T cell progenitors with little, if any, engraftment of HSCs [59]. This model is based upon the observation that although >90% of the peripheral T cells in successfully transplanted nonconditioned or nonmyeloablated XSCID and Jak3 SCID patients are donor-derived following BMT, <10% of the patients possess donor-derived B cells or myeloid cells [14, 59]. This model predicts that there would be a gradual decline in newly formed T cells after BMT in these patients, which is supported by the fact that TREC levels in these patients decline to very low levels by 10 to 12 years posttransplant [16, 59].

There may be qualitative differences in the numbers of infused HSC or committed lymphoid progenitors in the present experiment. All the donors in our study were neonatal puppies, whereas, the majority of human donors are older siblings or adults. Aspirates of human adult bone marrow contain approximately 1% to 2% CD34+ cells, whereas the proportion of CD34+ cells obtained by flushing fetal bone marrow is significantly higher with up to 20% CD34+ cells [54, 60, 61, 62]. Similar age-related differences exist in the proportion of CD34+ cells in the dog. Canine adult bone marrow contains approximately 2% CD34+ cells [28], whereas, the proportion of bone marrow CD34+ cells in neonatal canine bone marrow ranges between 8% and 14% [63]. Therefore, the use of neonatal donors in our canine whole BMTs resulted in the transplantation of between 4- and 7-fold more CD34+ cells and likely HSC than used in the similar human transplants. The dose of purified CD34+ bone marrow cells was similar to the dose of CD34+ cells contained in the whole bone marrow grafts. We have previously reported that transplantation of nonconditioned XSCID dogs with whole bone marrow or purified CD34+ cells does not result in donor myeloid chimerism, but, in contrast to human XSCID patients, >90% of successfully transplanted XSCID dogs demonstrate up to 20% donor B cell chimerism [23, 25]. The transplantation of significantly higher numbers of CD34+ bone marrow cells may result in the engraftment of a more immature lymphoid progenitor that could result in a more sustained T cell regeneration. This hypothesis can be tested by transplanting XSCID dogs with similar doses of CD34+ bone marrow cells as routinely used in transplantation of XSCID boys.

In conclusion, XSCID dogs develop a normal T cell repertoire following nonablative BMT similar to that observed in XSCID boys following nonablative BMT. However, in contrast to transplanted XSCID boys who show a significant decline in their T cell diversity by 10 to 12 years following BMT, transplanted XSCID dogs maintain a polyclonal, diverse T cell repertoire through midlife.

Back to Article Outline

Acknowledgments 

This study was supported by NIH Grants ROI AI43745 and ROI RR02512. The authors would like to thank Patty O’Donnell for excellent supervision of the XSCID dog colony.

Back to Article Outline

References 

  1. Rosen FS, Cooper MD, Wedgwood RJ. The primary immunodeficiencies. N Engl J Med. 1995;333:431–440
  2. Buckley RH, Schiff RI, Schiff SE, et al. Human severe combined immunodeficiency: genetic, phenotypic, and functional diversity in one hundred eight infants. [see comments] J Pediatr. 1997;130:378–387
  3. Fischer A, Haddad E, Jabado N, et al. Stem cell transplantation for immunodeficiency. Springer Semin Immunopathol. 1998;19:479–492
  4. Leonard WJ. The molecular basis of X-linked severe combined immunodeficiency: defective cytokine receptor signaling. Annu Rev Med. 1996;47:229–239
  5. Asao H, Okuyama C, Kumaki S, et al. Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol. 2001;167:1–5
  6. Gatti RA, Meuwissen HJ, Allen HD, Hong R, Good RA. Immunological reconstitution of sex-linked lymphopenic immunological deficiency. Lancet. 1968;2:1366–1369
  7. Buckley RH, Schiff SE, Schiff RI, et al. Haploidentical bone marrow stem cell transplantation in human severe combined immunodeficiency. Semin Hematol. 1993;30:92–101discussion 102-104
  8. Buckley RH, Schiff SE, Schiff RI, et al. Hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency. [see comments] N Engl J Med. 1999;340:508–516
  9. Haddad E, Landais P, Friedrich W, et al. Long-term immune reconstitution and outcome after HLA-nonidentical T-cell-depleted bone marrow transplantation for severe combined immunodeficiency: a European retrospective study of 116 patients. Blood. 1998;91:3646–3653
  10. Kapoor N, Crooks G, Kohn DB, Parkman R. Hematopoietic stem cell transplantation for primary lymphoid immunodeficiencies. Semin Hematol. 1998;35:346–353
  11. Dror Y, Gallagher R, Wara DW, et al. Immune reconstitution in severe combined immunodeficiency disease after lectin-treated, T-cell-depleted haplocompatible bone marrow transplantation. Blood. 1993;81:2021–2030
  12. Reisner Y, Kapoor N, Kirkpatrick D, et al. Transplantation for severe combined immunodeficiency with HLA-A,B,D,DR incompatible parental marrow cells fractionated by soybean agglutinin and sheep red blood cells. Blood. 1983;61:341–348
  13. van Leeuwen JE, van Tol MJ, Joosten AM, et al. Relationship between patterns of engraftment in peripheral blood and immune reconstitution after allogeneic bone marrow transplantation for (severe) combined immunodeficiency. Blood. 1994;84:3936–3947
  14. Haddad E, Le Deist F, Aucouturier P, et al. Long-term chimerism and B-cell function after bone marrow transplantation in patients with severe combined immunodeficiency with B cells: a single-center study of 22 patients. Blood. 1999;94:2923–2930
  15. Ting SS, Tangye SG, Wood J, French RA, Ziegler JB. Reduced memory B-cell populations in boys with B-cell dysfunction after bone marrow transplantation for X-linked severe combined immunodeficiency. Br J Haematol. 2001;112:1004–1011
  16. Patel DD, Gooding ME, Parrott RE, Curtis KM, Haynes BF, Buckley RH. Thymic function after hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency. N Engl J Med. 2000;342:1325–1332
  17. Sarzotti M, Patel DD, Li X, et al. T cell repertoire development in humans with SCID after nonablative allogeneic marrow transplantation. J Immunol. 2003;170:2711–2718
  18. Felsburg PJ, Somberg RL, Hartnett BJ, Henthorn PS, Carding SR. Canine X-linked severe combined immunodeficiency (A model for investigating the requirement for the common gamma chain (gamma c) in human lymphocyte development and function). Immunol Res. 1998;17:63–73
  19. Felsburg PJ, Hartnett BJ, Henthorn PS, Moore PF, Krakowka S, Ochs HD. Canine X-linked severe combined immunodeficiency. Vet Immunol Immunopathol. 1999;69:127–135
  20. Henthorn PS, Somberg RL, Fimiani VM, Puck JM, Patterson DF, Felsburg PJ. IL-2R gamma gene microdeletion demonstrates that canine X-linked severe combined immunodeficiency is a homologue of the human disease. Genomics. 1994;23:69–74
  21. Somberg RL, Robinson JP, Felsburg PJ. T lymphocyte development and function in dogs with X-linked severe combined immunodeficiency. J Immunol. 1994;153:4006–4015
  22. Hartnett BJ, Somberg RL, Krakowka S, et al. B-cell function in canine X-linked severe combined immunodeficiency. Vet Immunol Immunopathol. 2000;75:121–134
  23. Felsburg PJ, Somberg RL, Hartnett BJ, et al. Full immunologic reconstitution following nonconditioned bone marrow transplantation for canine X-linked severe combined immunodeficiency. Blood. 1997;90:3214–3221
  24. Hartnett BJ, Henthorn PS, Moore PF, Weinberg KI, Ochs HD, Felsburg PJ. Bone marrow transplantation for canine X-linked severe combined immunodeficiency. Vet Immunol Immunopathol. 1999;69:137–144
  25. Hartnett BJ, Yao DP, Suter SE, et al. Transplantation of X-linked severe combined immunodeficient dogs with CD34+ bone marrow cells. Biol Blood Marrow Transplant. 2002;8:188–197
  26. Somberg RL, Pullen RP, Casal ML, Patterson DF, Felsburg PJ, Henthorn PS. A single nucleotide insertion in the canine interleukin-2 receptor gamma chain results in X-linked severe combined immunodeficiency disease. Vet Immunol Immunopathol. 1995;47:203–213
  27. Wagner JL, Burnett RC, DeRose SA, Francisco LV, Storb R, Ostrander EA. Histocompatibility testing of dog families with highly polymorphic microsatellite markers. Transplantation. 1996;62:876–877
  28. McSweeney PA, Rouleau KA, Wallace PM, et al. Characterization of monoclonal antibodies that recognize canine CD34. Blood. 1998;91:1977–1986
  29. Cobbold S, Metcalfe S. Monoclonal antibodies that define canine homologues of human CD antigens: summary of the First International Canine Leukocyte Antigen Workshop (CLAW). Tissue Antigens. 1994;43:137–154
  30. Moore PF, Rossitto PV, Olivry T. Development of monoclonal antibodies to canine T cell receptor-γδ (TCR-γδ) and their utilization in the diagnosis of epidermotropic cutaneous T cell lymphoma. Vet Pathol. 1994;31:597
  31. Zhai Y, Li J, Hammer M, Busuttil RW, Volk HD, Kupiec-Weglinski JW. Evidence of T cell clonality in the infectious tolerance pathway: implications toward identification of regulatory T cells. Transplantation. 2001;71:1701–1708
  32. Mackall CL, Granger L, Sheard MA, Cepeda R, Gress RE. T-cell regeneration after bone marrow transplantation: differential CD45 isoform expression on thymic-derived versus thymic-independent progeny. Blood. 1993;82:2585–2594
  33. Mackall CL, Fleisher TA, Brown MR, et al. Age, thymopoiesis, and CD4+ T-lymphocyte regeneration after intensive chemotherapy. [see comments] N Engl J Med. 1995;332:143–149
  34. Muller SM, Kohn T, Schulz AS, Debatin KM, Friedrich W. Similar pattern of thymic-dependent T-cell reconstitution in infants with severe combined immunodeficiency after human leukocyte antigen (HLA)-identical and HLA-nonidentical stem cell transplantation. [In Process Citation] Blood. 2000;96:4344–4349
  35. Weinberg K, Annett G, Kashyap A, Lenarsky C, Forman SJ, Parkman R. The effect of thymic function on immunocompetence following bone marrow transplantation. Biol Blood Marrow Transplant. 1995;1:18–23
  36. Weinberg K, Blazar BR, Wagner JE, et al. Factors affecting thymic function after allogeneic hematopoietic stem cell transplantation. Blood. 2001;97:1458–1466
  37. De Paoli P, Battistin S, Santini GF. Age-related changes in human lymphocyte subsets: progressive reduction of the CD4 CD45R (suppressor inducer) population. Clin Immunol Immunopathol. 1988;48:290–296
  38. Erkeller-Yuksel FM, Deneys V, Yuksel B, et al. Age-related changes in human blood lymphocyte subpopulations. J Pediatr. 1992;120:216–222
  39. Hulstaert F, Hannet I, Deneys V, et al. Age-related changes in human blood lymphocyte subpopulations (II. Varying kinetics of percentage and absolute count measurements). Clin Immunol Immunopathol. 1994;70:152–158
  40. Lopez-Hoyos M, Bartolome-Pacheco MJ, Blanco R, Rodriguez-Valverde V, Martinez-Taboada VM. Selective T cell receptor decrease in peripheral blood T lymphocytes of patients with polymyalgia rheumatica and giant cell arteritis. Ann Rheum Dis. 2004;63:54–60
  41. Buckley RH, Schiff SE, Sampson HA, et al. Development of immunity in human severe primary T cell deficiency following haploidentical bone marrow stem cell transplantation. J Immunol. 1986;136:2398–2407
  42. Holdrinet RS, von Egmond J, Wessels JM, Haanen C. A method for quantification of peripheral blood admixture in bone marrow aspirates. Exp Hematol. 1980;8:103–107
  43. Fischer A, Durandy A, de Villartay JP, et al. HLA-haploidentical bone marrow transplantation for severe combined immunodeficiency using E rosette fractionation and cyclosporine. Blood. 1986;67:444–449
  44. Reinherz EL, Geha R, Rappeport JM, et al. Reconstitution after transplantation with T-lymphocyte-depleted HLA haplotype-mismatched bone marrow for severe combined immunodeficiency. Proc Natl Acad Sci USA. 1982;79:6047–6051
  45. Hingorani R, Choi IH, Akolkar P, et al. Clonal predominance of T cell receptors within the CD8+ CD45RO+ subset in normal human subjects. J Immunol. 1993;151:5762–5769
  46. Posnett DN, Sinha R, Kabak S, Russo C. Clonal populations of T cells in normal elderly humans: the T cell equivalent to “benign monoclonal gammapathy.”. J Exp Med. 1994;179:609–618
  47. Gregersen PK, Hingorani R, Monteiro J. Oligoclonality in the CD8+ T-cell population (Analysis using a multiplex PCR assay for CDR3 length). Ann N Y Acad Sci. 1995;756:19–27
  48. Naylor K, Li G, Vallejo AN, et al. The influence of age on T cell generation and TCR diversity. J Immunol. 2005;174:7446–7452
  49. Hamann D, Kostense S, Wolthers KC, et al. Evidence that human CD8+CD45RA+CD27-cells are induced by antigen and evolve through extensive rounds of division. Int Immunol. 1999;11:1027–1033
  50. Faint JM, Annels NE, Curnow SJ, et al. Memory T cells constitute a subset of the human CD8+CD45RA+ pool with distinct phenotypic and migratory characteristics. J Immunol. 2001;167:212–220
  51. Glickman LT, Domanski LM. An alternative to laboratory animal experimentation for human health risk assessment: epidemiological studies of pet animals. ALTA. 1986;13:267–285
  52. Myers LA, Patel DD, Puck JM, Buckley RH. Hematopoietic stem cell transplantation for severe combined immunodeficiency in the neonatal period leads to superior thymic output and improved survival. Blood. 2002;99:872–878
  53. Bensinger WI, Buckner CD, Shannon-Dorcy K, et al. Transplantation of allogeneic CD34+ peripheral blood stem cells in patients with advanced hematologic malignancy. Blood. 1996;88:4132–4138
  54. Krause DS, Fackler MJ, Civin CI, May WS. CD34: structure, biology, and clinical utility. [see comments] Blood. 1996;87:1–13
  55. Morel F, Szilvassy SJ, Travis M, Chen B, Galy A. Primitive hematopoietic cells in murine bone marrow express the CD34 antigen. Blood. 1996;88:3774–3784
  56. Berenson RJ, Andrews RG, Bensinger WI, et al. Antigen CD34+ marrow cells engraft lethally irradiated baboons. J Clin Invest. 1988;81:951–955
  57. Andrews RG, Bryant EM, Bartelmez SH, et al. CD34+ marrow cells, devoid of T and B lymphocytes, reconstitute stable lymphopoiesis and myelopoiesis in lethally irradiated allogeneic baboons. Blood. 1992;80:1693–1701
  58. Bruno B, Nash RA, Wallace PM, et al. CD34+ selected bone marrow grafts are radioprotective and establish mixed chimerism in dogs given high dose total body irradiation. Transplantation. 1999;68:338–344
  59. Fischer A, Le Deist F, Hacein-Bey-Abina S, et al. Severe combined immunodeficiency (A model disease for molecular immunology and therapy). Immunol Rev. 2005;203:98–109
  60. Wu AG, Michejda M, Mazumder A, et al. Analysis and characterization of hematopoietic progenitor cells from fetal bone marrow, adult bone marrow, peripheral blood, and cord blood. Pediatr Res. 1999;46:163–169
  61. DiGiusto D, Chen S, Combs J, et al. Human fetal bone marrow early progenitors for T, B, and myeloid cells are found exclusively in the population expressing high levels of CD34. Blood. 1994;84:421–432
  62. Turner CW, Yeager AM, Waller EK, Wingard JR, Fleming WH. Engraftment potential of different sources of human hematopoietic progenitor cells in BNX Mice. Blood. 1996;87:3237–3244
  63. Suter SE, Gouthro TA, McSweeney PA, et al. Isolation and characterization of pediatric canine bone marrow CD34+ cells. Vet Immunol Immunopathol. 2004;101:31–47

 The first 2 authors contributed equally to this work.

PII: S1083-8791(07)00306-0

doi:10.1016/j.bbmt.2007.05.013

Biology of Blood and Marrow Transplantation
Volume 13, Issue 9 , Pages 1005-1015, September 2007

Article Tools

* Image Usage & Resolution